*Target (protein/gene name):Shiga Toxin Subunit B *NCBI Gene # or RefSeq#: 3796556 *Protein ID (NP or XP #) or Wolbachia#:NC_007606.1 *Organism (including strain): S. dysenteriae Etiologic Risk Group (see link below):Risk Group 2 Bacterial Agents including Chlamydia __https://my.absa.org/tiki-index.php?page=Riskgroups__
*Disease Information (sort of like the Intro to your Mini Research Write up): Shigellosis is an infectious foodborne illness caused by bacteria of the Escherichia and Shigella genus. This infectious disease is usually transmitted by physical contact between humans and a hand to mouth contact for the bacteria to infect humans. Food is another source of transmission. Symptoms of Shigella may vary from abdominal discomfort to cramps, diarrhea, slimy stools, fever, pus or mucus in stools, tenesmus, or seizures. Shigella is a deadly disease that prevalently affects children of developing countries. Furthermore, Shigella is resistant to traditional first line antibiotics such as ampicillin.
Essentiality of this protein: The enzyme induces a cytotoxic enzyme that inhibits protein synthesis through inactivating the ribosomes within target cells. The enzyme targets the cell surface of the target cell and undergoes endocytosis and transport to the endoplasmic reticulum. Then the active part is set free and translocated to the cytosol dependent on several factors. In the cytosol the toxin attacks its target.
Complex of proteins?: Yes Druggable Target (list number or cite evidence from a paper/database showing druggable in another organism): Pteroic acid (PTA) and 4-[3-(2-amino-1,4-dihydro-6-hydroxy-4-oxo-5-pyrimidinyl)propyl]-benzoic acid (PBA) has been found to be a drug candidate that have yielded low IC50 values in enzyme assays. __http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2929769/__ *EC#: 3.2.2.22 Link to BRENDA EC# page: __http://www.brenda-enzymes.org/enzyme.php?ecno=3.2.2.22__ Figure 1. Reaction catalyzed by rRNA N-glycosylase (3.2.2.22). Screenshot from BRENDA.
Enzyme Assay information (spectrophotometric, coupled assay, reagents): -- link to Sigma (or other company) page for assay (see Sigma links below) __http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2929769/__ Ricin assay is performed by using Shiga toxin to inhibit translational ribosomal proteins from translating luciferase. -- links to assay reagents (substrates) pages. No reagents involved in this assay. Ricin assay was used instead. Link about assay included above. --- List cost and quantity of substrate reagents, supplier, and catalog # Cost and Quantity: $275.50 for 0.5mg Supplier: Sigma Aldrich Catalog #: SML0562
Expression Information (has it been expressed in bacterial cells):This protein has been expressed in E. coli and S. dysenteriae cells. Purification Method: The supernatant was filter sterilized with a 0.22 µm syringe filter before being applied to the chitin column for purification. __http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2929769/__
Image of protein (PyMol with features delineated and shown separately): Figure 3. Pymol representation of Shiga Toxin Subunits (PDBID: 1DM0) colored by chains shown in cartoon (1DM0.pdb).
*Amino Acid Sequence (paste as text only - not as screenshot or as 'code'): TPDCVTGKVE YTKYNDDDTF TVKVGDKELF TNRWNLQSLL LSAQITGMTV TIKTNACHNG GGFSEVIFR
*Length of your protein in Amino Acids:69 Molecular Weight of your protein in kiloDaltons using the __Expasy ProtParam__ website:7690.66 Molar Extinction coefficient of your protein at 280 nm wavelength: Ext. coefficient 8605 Abs 0.1% (=1 g/l) 1.119, assuming all pairs of Cys residues form cystines
Ext. coefficient 8480 Abs 0.1% (=1 g/l) 1.103, assuming all Cys residues are reduced
*CDS Gene Sequence (paste as text only): >gi|82775382:1284822-1285091 Shigella dysenteriae Sd197 chromosome, complete genome ATGAAAAAAACATTATTAATAGCTGCATCGCTTTCATTTTTTTCAGCAAGTGCGCTGGCGACGCCTGATT GTGTAACTGGAAAGGTGGAGTATACAAAATATAATGATGACGATACCTTTACAGTTAAAGTGGGTGATAA AGAATTATTTACCAACAGATGGAATCTTCAGTCTCTTCTTCTCAGTGCGCAAATTACGGGGATGACTGTA ACCATTAAAACTAATGCCTGTCATAATGGAGGGGGATTCAGCGAAGTTATTTTTCGTTGA
*GC% Content for gene: 11.594203% *CDS Gene Sequence (codon optimized) - copy from output of Primer Design Protocol (paste as text only): *GC% Content for gene (codon optimized):
Do Not Need this info for Spring (but still copy these lines to your Target page for now) Primer design results for pNIC-Bsa4 cloning (list seqeunces of all of your ~40 nt long primers): (link to DNA Works output text file - that should be saved in your Google Docs folder after you did the primer design protocol) -- Ask a mentor, Dr. B, or a fellow researcher -how to link a GDocs file if you are not sure how to. Primer design results for 'tail' primers (this is just 2 sequences): **
*NCBI Gene # or RefSeq#: 3796556
*Protein ID (NP or XP #) or Wolbachia#:NC_007606.1
*Organism (including strain): S. dysenteriae
Etiologic Risk Group (see link below):Risk Group 2 Bacterial Agents including Chlamydia
__https://my.absa.org/tiki-index.php?page=Riskgroups__
*Disease Information (sort of like the Intro to your Mini Research Write up):
Shigellosis is an infectious foodborne illness caused by bacteria of the Escherichia and Shigella genus.
This infectious disease is usually transmitted by physical contact between humans and a hand to mouth contact for the bacteria to infect humans. Food is another source of transmission. Symptoms of Shigella may vary from abdominal discomfort to cramps, diarrhea, slimy stools, fever, pus or mucus in stools, tenesmus, or seizures. Shigella is a deadly disease that prevalently affects children of developing countries. Furthermore, Shigella is resistant to traditional first line antibiotics such as ampicillin.
Link to TDR Targets page (if present):n/a
Link to Gene Database page (NCBI, EuPath databases -e.g. TryTryp, PlasmoDB, etc - or PATRIC, etc.)
__http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=622__
Essentiality of this protein:
The enzyme induces a cytotoxic enzyme that inhibits protein synthesis through inactivating the ribosomes within target cells. The enzyme targets the cell surface of the target cell and undergoes endocytosis and transport to the endoplasmic reticulum. Then the active part is set free and translocated to the cytosol dependent on several factors. In the cytosol the toxin attacks its target.
Is it a monomer or multimer as biological unit? (make prediction at http://www.ebi.ac.uk/msd-srv/prot_int/pistart.html)
Most probable biological assembly: pentamer
http://www.ebi.ac.uk/msd-srv/prot_int/cgi-bin/piserver
Complex of proteins?: Yes
Druggable Target (list number or cite evidence from a paper/database showing druggable in another organism):
Pteroic acid (PTA) and 4-[3-(2-amino-1,4-dihydro-6-hydroxy-4-oxo-5-pyrimidinyl)propyl]-benzoic acid (PBA) has been found to be a drug candidate that have yielded low IC50 values in enzyme assays.
__http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2929769/__
*EC#: 3.2.2.22
Link to BRENDA EC# page: __http://www.brenda-enzymes.org/enzyme.php?ecno=3.2.2.22__
Figure 1. Reaction catalyzed by rRNA N-glycosylase (3.2.2.22). Screenshot from BRENDA.
Enzyme Assay information (spectrophotometric, coupled assay, reagents):
-- link to Sigma (or other company) page for assay (see Sigma links below)
__http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2929769/__
Ricin assay is performed by using Shiga toxin to inhibit translational ribosomal proteins from translating luciferase.
-- links to assay reagents (substrates) pages.
No reagents involved in this assay. Ricin assay was used instead. Link about assay included above.
--- List cost and quantity of substrate reagents, supplier, and catalog #
Cost and Quantity: $275.50 for 0.5mg
Supplier: Sigma Aldrich
Catalog #: SML0562
Structure (PDB or Homology model)
__http://www.rcsb.org/pdb/explore/explore.do?structureId=1DM0__
Figure 2. PDB Structure of Shiga Toxin (PDBID: 1DM0).
-- PDB # or closest PDB entry if using homology model
PDBID: 1DM0
Current Inhibitors:
- ((5-(2-amino-4,6-dihydroxy-5-pyrimidinyl)pentanoyl)amino)acetic acid
- 2-methylsulfonyl-1-(naphthalen-1-ylmethyl)benzimidazole
- 2,2-dimethyl-4-[(E)-2-phenylethenyl]-2,3-dihydro-1H-1,5-benzodiazepine
List of Inhibitors__http://www.brenda-enzymes.org/enzyme.php?ecno=3.2.2.22#INHIBITORS__
Expression Information (has it been expressed in bacterial cells):This protein has been expressed in E. coli and S. dysenteriae cells.
Purification Method: The supernatant was filter sterilized with a 0.22 µm syringe filter before being applied to the chitin column for purification.
__http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2929769/__
Image of protein (PyMol with features delineated and shown separately):
Figure 3. Pymol representation of Shiga Toxin Subunits (PDBID: 1DM0) colored by chains shown in cartoon (1DM0.pdb).
*Amino Acid Sequence (paste as text only - not as screenshot or as 'code'):
TPDCVTGKVE YTKYNDDDTF TVKVGDKELF TNRWNLQSLL LSAQITGMTV TIKTNACHNG GGFSEVIFR
*Length of your protein in Amino Acids:69
Molecular Weight of your protein in kiloDaltons using the __Expasy ProtParam__ website:7690.66
Molar Extinction coefficient of your protein at 280 nm wavelength:
Ext. coefficient 8605
Abs 0.1% (=1 g/l) 1.119, assuming all pairs of Cys residues form cystines
Ext. coefficient 8480
Abs 0.1% (=1 g/l) 1.103, assuming all Cys residues are reduced
TMpred graph Image (__http://www.ch.embnet.org/software/TMPRED_form.html__).
Figure 4. TMpred graph of Shiga Toxin Subunit B.
*CDS Gene Sequence (paste as text only):
>gi|82775382:1284822-1285091 Shigella dysenteriae Sd197 chromosome, complete genome
ATGAAAAAAACATTATTAATAGCTGCATCGCTTTCATTTTTTTCAGCAAGTGCGCTGGCGACGCCTGATT
GTGTAACTGGAAAGGTGGAGTATACAAAATATAATGATGACGATACCTTTACAGTTAAAGTGGGTGATAA
AGAATTATTTACCAACAGATGGAATCTTCAGTCTCTTCTTCTCAGTGCGCAAATTACGGGGATGACTGTA
ACCATTAAAACTAATGCCTGTCATAATGGAGGGGGATTCAGCGAAGTTATTTTTCGTTGA
*GC% Content for gene: 11.594203%
*CDS Gene Sequence (codon optimized) - copy from output of Primer Design Protocol (paste as text only):
*GC% Content for gene (codon optimized):
Do Not Need this info for Spring (but still copy these lines to your Target page for now)
Primer design results for pNIC-Bsa4 cloning (list seqeunces of all of your ~40 nt long primers):
(link to DNA Works output text file - that should be saved in your Google Docs folder after you did the primer design protocol)
-- Ask a mentor, Dr. B, or a fellow researcher -how to link a GDocs file if you are not sure how to.
Primer design results for 'tail' primers (this is just 2 sequences):
**